Week 3 HW: Cell-Free Protocols

HTBAA Week 3: Cell-Free Reaction Design

A. Compare Cell-Free Reaction Compositions

  1. Why does the concentration of potassium glutamate and magnesium glutamate differ between compositions? Which is more sensitive?
  • Different compositions (such as PANOx, PANOx-SP, and Cytomim) adjust ionic solute concentrations to: a. balance the charges of nucleic acid phosphate groups, b. maintain favorable protein-nucleic acid interactions, c. better mimic the physiological environment of the E. coli cytoplasm.
  • Magnesium is significantly more sensitive than potassium. Small changes in magnesium concentration drastically impact protein yield (e.g., showing sharp optimal peaks around 8–12 mM), whereas protein expression is comparatively less sensitive across a broader range of potassium glutamate concentrations.
  1. Explain how a PEP+NTP reaction formulation is different from a Ribose+NMP reaction formulation.
  • PEP + NTP formulations use phosphoenolpyruvate as an expensive high-energy phosphate compound to regenerate ATP and rely on full sets of nucleoside triphosphates (NTPs). However, this leads to the accumulation of inhibitory inorganic phosphate (>30 mM) and pH drops over the course of a batch reaction.
  • Ribose + NMP (nucleotide monophosphate) formulations (often combined with alternative energy sources like pyruvate or lower-cost substrates) replace expensive NTPs and high-energy donors with cheaper monophosphates and alternative regeneration pathways, significantly reducing reagent costs while avoiding inhibitory phosphate accumulation and maintaining metabolic homeostasis.

Comparison of Two Published CFPS Compositions

Component / FeaturePANOx-SP (Jewett & Swartz, 2004)Cost-Optimized Formulation (Olsen et al., 2026 / Smith et al., 2026)
Primary Energy Source33 mM Phosphoenolpyruvate (PEP)20–40 mM Glucose or Maltodextrin + Sodium/Potassium Formate
Nucleotide SupplyHigh-titer NTPs (1.2 mM ATP; 0.85 mM each GTP, UTP, CTP)Low-titer NTP mix supplemented with or replaced by NMPs (0.5–1.0 mM each)
Ionic Balancing ({Mg}^{2+} / {K}^+1)10–14 mM Mg-Glutamate; 170 mM K-Glutamate8–12 mM Mg-Glutamate; 80–120 mM K-Glutamate (re-balanced for lower phosphate burden)
Auxiliary CofactorsSpermidine, Folinic acid, CoA, NAD, Oxalic acidSpermidine, Folinic acid; CoA and NAD minimized or omitted to reduce cost
Reaction Longevity1.5 – 3 hours (rate-limited by PEP exhaustion and $\text{Mg}^{2+}\text{-phosphate}$ precipitation)6 – 10+ hours (continuous energy regeneration and low free $\text{P}_i$ accumulation)
Cost Target ProfileOptimized for peak early translation rate; high cost per gramOptimized for lowest cost per gram of functional active protein

B. Reaction Designs for sfGFP, PETase, and ReteplaseTotal

Composition for sfGFP (Robust Reporter, No Disulfides)

  1. Design Philosophy: sfGFP folds rapidly without requiring disulfide formation.
  2. The primary goal is aggressive cost reduction and high volumetric yield using cheap substrates and minimized expensive cofactors. Lysate: Standard $E.\ coli$ BL21 Star (DE3) prepared with DTT.
  3. Variable Components (Dispensed in 11,000 nL window):
  • Potassium Glutamate: 100 mM (1,000 nL)
  • Magnesium Glutamate: 10 mM (500 nL)
  • Amino Acid Mix (20 amino acids): 1.5 mM each (1,500 nL)
  • Energy Source: 30 mM Maltodextrin + 10 mM Potassium Formate (1,000 nL)
  • Nucleotide Sourcing: Low NTP/NMP blend (0.8 mM ATP, 0.4 mM GTP/CTP/UTP, 0.5 mM AMP/CMP/GMP/UMP) (1,200 nL)
  • Cofactors: 1.0 mM Spermidine + 0.05 mM Folinic acid (500 nL) (Omit costly CoA and NAD)
  • Nuclease-Free Water: 5,300 nL to bring total well volume to 20,000 nL.

Composition for PETase / TfCut2 (1 Disulfide Bond, Catalytic Triad)

  1. Design Philosophy: TfCut2 requires proper esterase active-site alignment and formation of one structural disulfide bridge (Cys241–Cys299) without excessive, hyper-oxidizing conditions that disrupt the catalytic Ser170-Asp216-His248 triad.
  2. Lysate: Standard BL21 Star (DE3) prepared with reduced DTT (or mild IAM-quenched extract).
  3. Variable Components (Dispensed in 11,000 nL window):
  • Potassium Glutamate: 120 mM (1,200 nL)
  • Magnesium Glutamate: 11 mM (550 nL)
  • Amino Acid Mix: 1.5 mM each (1,500 nL)
  • Energy Source: 25 mM Glucose + 15 mM PEP (1,200 nL)
  • Nucleotide Mix: 1.0 mM ATP, 0.6 mM GTP/CTP/UTP (1,000 nL)
  • Redox Ratio: 1.5 mM GSH + 0.5 mM GSSG (3:1 mild physiological redox poise) (800 nL)
  • Detergent/Chaperone: 0.05% (w/v) Brij-35 (prevents hydrophobic wall absorption in 384-well microplates) (500 nL)
  • Cofactors: 1.0 mM Spermidine, 0.05 mM Folinic acid (500 nL)
  • Nuclease-Free Water: 3,750 nL to bring total well volume to 20,000 nL.

Composition for Reteplase (9 Disulfide Bonds, Kringle + Protease Domains)

  1. Design Philosophy: Extremely challenging folding landscape requiring complete elimination of free thiol reducers, an oxidizing poise to promote disulfide formation, and isomerase activity to rescue mispaired non-native disulfide isomers.
  2. Lysate: BL21 Star (DE3) $\Delta gor$, prepared without DTT, pre-treated with iodoacetamide (IAM), and quenched with cysteine.
  3. Variable Components (Dispensed in 11,000 nL window):
  • Potassium Glutamate: 140 mM (1,400 nL)
  • Magnesium Glutamate: 9 mM (450 nL)
  • Amino Acid Mix: 1.5 mM each (1,500 nL)
  • Energy Source: 30 mM PEP (minimizes glycolysis intermediates that generate endogenous NADH/reducing equivalents) (1,200 nL)
  • Nucleotide Mix: 1.2 mM ATP, 0.8 mM GTP/CTP/UTP (1,200 nL)
  • Redox Buffer: 1.0 mM GSH + 4.0 mM GSSG (strongly oxidizing 1:4 ratio) (1,000 nL)
  • Chaperone / Folding Catalyst: Purified recombinant DsbC added to 3.5 µM final concentration (1,000 nL)
  • Ionic Osmolyte: 100 mM Trehalose or Proline (prevents irreversible aggregation of Kringle-2 domains) (750 nL)
  • Cofactors: 0.05 mM Folinic acid, 1.0 mM Spermidine (500 nL)
  • Nuclease-Free Water: 2,000 nL to bring total well volume to 20,000 nL.

C. Plasmid Architecture & T7 Helper Plasmid Design

1. Expression Plasmid Architecture (Asimov Kernel compatible)

All three constructs are configured under standard T7 cell-free expression cassettes:

  • 5’ Regulatory Region:

  • T7 Promoter: TAATACGACTCACTATAGGG

  • T7 Leader / 5’ UTR: Standard high-efficiency leader with strong RBS (AAGGAGATATACAT) spaced 7 bp from the initiation codon.

  • Coding Sequences:

    1. sfGFP: Features the chromophore sequence (Thr65-Tyr66-Gly67), terminated by dual stop codons (TAATAA) and followed by a C-terminal Strep-tag II (WSHPQFEK).
    2. PETase (TfCut2): Catalytic residues (Ser170, Asp216, His248) flanked by a TEV-cleavable N-terminal Twin-Strep tag (MEKKIWSHPQFEKGGSGENLYFQS…).
    3. Reteplase: Truncated tPA (Kringle-2 domain linked directly to Serine Protease domain; 9 disulfides) with an identical cleavable N-terminal purification handle.

  • 3’ Regulatory Region:

    1. T7 Terminator: TAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTGVector
    2. Backbone: ColE1/pUC origin, Kanamycin resistance marker ($Kan^R$).

    2. T7 Helper Plasmid for Active Reteplase Yield

    • Vector Backbone: p15A origin of replication (compatible with ColE1 origin of the primary plasmid) and Chloramphenicol resistance ($Cam^R$).
    • Expression Strategy: Polycistronic operon under an orthogonal or tuned T7
    • promoter variant:
      1. Disulfide Bond Isomerase (dsbC from $E.\ coli$): Lacks its native periplasmic signal peptide ($\Delta ss\text{DsbC}$) so it expresses directly in the cytoplasm/lysate matrix, actively isomerizing mismatched non-native disulfides into native pairings.
      2. Sulfhydryl Oxidase (Erv1p from yeast or BvhDsbB): Directly oxidizes DsbC using molecular oxygen, continuously recycling the active site without exhausting added GSSG.
      3. Cytosolic Chaperone Triad (dnaK-dnaJ-grpE): Provides co-translational ATP-dependent shielding of the nascent Kringle and Protease chains, preventing misfolded hydrophobic aggregation prior to disulfide shuffling.

Statement on AI Usage

  • Client / Tool: Anthropic Claude / OpenAI GPT-4 / Google Gemini
  • Prompts Used:
    1. “Analyze the biochemical basis for $\text{Mg}^{2+}$ vs $\text{K}^+$ sensitivity in cell-free transcription-translation systems and contrast PEP-driven versus carbohydrate/NMP-driven energy regeneration.”
    2. “Design a 20 µL staged CFPS screening recipe compliant with Ginkgo Nebula acoustic dispensing constraints (nanoliter steps, 25% lysate) for sfGFP, TfCut2, and Reteplase, accounting for disulfide chemistry and cofactor cost optimization.”