Week 1 HW: Final Project Ideas

Engineering Halomonas for Enhanced PHA Production and Its Biomedical Devices Applications

(1) What do you want to make?

My previous research dealt with the optimization of fermentation conditions to produce PHA using wild type Bacillus megaterium. The PHA molecules can be intended as biomaterial for biomedical devices, such as tissue engineering scaffold, surgical sutures, and wound dressing film. PHA is synthesized and accumulated by microorganisms as a form of stored carbon and energy. It is a family of polymers with varying numbers of monomers, which lead to different characteristics, namely mechanical strength, flexibility, degradation rate, molecular weight, crystallinity, surface property, etc. Essential uses of PHA for biomedical devices include biocompatibility, controlled biodegradability, and ability to be broken down into non-toxic compounds. The molecule itself is particularly interesting for me due to its versatile applications and variability based on the monomers and potential combination with other polymers.

(2) What living system could make it?

Generally, living systems used to produce PHA for biomedical devices are categorized within the Gram-positive bacteria group as its cell wall structure does not contain LPS and toxins, which might contaminate the extracted product. However, after reading one of the articles related to genetic engineering of extremophiles, Halomonas sp. might provide an additional benefit for its tolerance to extreme salt concentration. The ability surely reduces the reliance on strict sterilization as the condition would be unsuitable to support general microorganism. It also demonstrated high production of PHA, up to 70-90% of its dry cell weight, depending on the substrate. Moreover, various carbon sources can be used as the substrate to produce the PHA. Although less information is known compared to the established microbes systems, Halomonas have been utilized for copolymer production through genetic engineering.

Here are the metabolic pathways from engineered Halomonas (Coimbra et al. 2025). The PHA biosynthesis is the one color light blue. Generally, there are three different routes of PHA production:

• Acetyl-CoA pathway

Production of short chain length PHA through PhaA, PhaB, and PhaC.

• Fatty-acid de novo synthesis pathway

Oxidation of carbon source into acetyl-coA through catalytic role of PhaG.

• Fatty-acid beta-oxidation pathway

Degradation of fatty-acid intermediates to generate hydroxyacyl-CoA precursors, involving PhaJ.

During the initial production of PHAs by Halomonas sp., previous research has explored using simple substrates, such as glucose, rhamnose, mixed volatile fatty acids, and glycerol. Low-cost waste substrates have also been utilized, such as molasses, waste frying oil, dairy waste, and crude glycerol, though being mentioned for its low yield.

Hence, modification of its genome can be done as a strategy to enhance the yield and productivity, while utilizing its ability to grow under unsterile-fermentation conditions. Overexpression is targeted toward a gene or multiple genes related to PHA production and its stability over generations should be monitored.

Some of the workflows:

• Wild-type baseline and strain selection
• Genetic engineering strategy selection
• Construction and codon optimization for Halomonas
• Screen and characterize PHA production
• Optimize and stabilize the production process in lab-scale
• Scale-up through bioreactors and automations
• Harvest, recover, and purify PHA
• Evaluate of the biomedical device suitability

(3) How could automation help you make it?

The system aims to improve consistency across batches, reduce repetitive manual work and human error, enable systematic experimentation, and improve data collection throughout the PHA production process. I imagined it to be an integrated machine for cultivation and sampling systems that support microbial cultivation, automated sampling, measurement, and PHA recovery.

The system would maintain a controlled and enclosed cultivation environment with continuous monitoring that can be adjusted. Important parameters might include salinity, temperature, pH, dissolved oxygen, and other cultivation conditions. The system must account for material compatibility with high saline media, contamination control, and scalability.

This automation would support reproducible experimentation by standardizing cultivation and sampling procedures and minimizing variation between batches. The sampling and measurement could also enable more detailed monitoring of biomass growth, nutrient consumption, and PHA accumulation, with automated quantification of data, including dry cell weight, PHA mass, PHA concentration, and PHA yield.

(4) What would it take to make it at a meaningful scale?

The initial target is a research prototype for tissue engineering scaffold. The focus is for production and characterization of the PHA-based material. The intended number of devices is 10 scaffolds, with 0,5 gram each. Hence, the total will be 5 grams. For reject processing and initial characterization will take 20% each. The target total of that production will be 7 grams.

Parameters of production must be determined, including the working volume of culture, biomass concentration (g/L), PHA content, recovery yield of the PHA, as well as the production time and harvesting time.

Information:

• Working volume (V): 1L
• Biomass concentration (B): 5 g/L
• PHA content (P): 70%
• Recovery yield (Y): 60%
• Cultivation time (T): 48 hours
• Parallel experiment: none, only one

From that information, the hypothetical calculation is:

• Recovery of PHA/batch = V x B x P x Y
• Recovery of PHA/batch = 1 x 5 x 70% x 60% = 2,1 g

So, the number of batches required to produce the target is:

• Total of batches = target PHA / recovery of PHA/batch = 7 / 2,1 = 3,33 = 4 batches

Since one cultivation time takes 48 hours, the process might take more than that due to the system preparation, harvest and recovery process, and cleaning, which might add a total of 12 hours. Roughly, that will be 60 hours in total. So the total time of 4 batches is 240 hours (10 days).

(5) What don’t you know yet?

I have not explored much on extremophiles, especially Halomonas, and all the answers are based on hypotheses and some of the journals that I have read briefly. So the gaps that need to be bridged are:

• What dry biomass concentration and intracellular PHA content can be achieved under the selected cultivation conditions from a particular substrate?
• How do changes in cultivation conditions or genetic modifications affect biomass production, PHA accumulation, and polymer properties?
• Are the cultivation conditions required by extremophiles compatible with the proposed bioreactor and automated production system?
• Can these conditions be maintained consistently throughout the production process?
• Are the properties of the produced PHA consistent between batches?

AI Use Disclosure

I use AI (ChatGPT (OpenAI)) to assist with calculations, clarifying production parameters, and identifying assumptions and potential limitations to the plan.

Prompts Used: Calculator example and verification Parameters that might be critical during fermentation Clarification of the knowledge gaps

References

Coimbra, A. a. B., Prakash, S., Jiménez, J. I., & Rios-Solis, L. (2025). Establishing Halomonas as a chassis for industrial biotechnology: advances in synthetic biology tool development and metabolic engineering strategies. Microbial Cell Factories, 24(1), 133. https://doi.org/10.1186/s12934-025-02757-2

Muigano, M. N., Mauti, G. O., Anami, S. E., & Onguso, J. M. (2025). Advances and challenges in polyhydroxyalkanoates (PHA) production using Halomonas species: A review. International Journal of Biological Macromolecules, 309(Pt 1), 142850. https://doi.org/10.1016/j.ijbiomac.2025.142850

Ye, J., Lin, Y., Yi, X., Yu, Z., Liu, X., & Chen, G. (2022). Synthetic biology of extremophiles: a new wave of biomanufacturing. Trends in Biotechnology, 41(3), 342–357. https://doi.org/10.1016/j.tibtech.2022.11.010

Week 2 HW: DNA Design

Repository name: Tan Rendy

Part 1: Define your expression target

What molecule are you expressing? A protein, an RNA, or an enzyme (or small set of enzymes) for a pathway. If your HW1 product is a material, food, or chemical, identify the protein(s) that produce it and design for those.

The target is poly(3-hydroxybutyrate) (PHB), a biodegradable bioplastic produced through a biosynthetic pathway. Since PHB is a polymer rather than a protein, the design will express three enzymes involved in its biosynthesis: phaA (β-ketothiolase), phaB (acetoacetyl-CoA reductase), and phaC (PHA synthase). These enzymes work together to convert acetyl-CoA into PHB. The goal is to increase PHB production in Halomonas bluephagenesis TD02.

What is the sequence? Give the protein or RNA sequence, or the specific gene, you will encode, and say where it comes from (a database accession such as UniProt or NCBI, a known part, or de novo). Cite it.

	
>NZ_GL949763.1:11969-13156 bktB [protein_accession=WP_009724931.1] [organism=Halomonas sp. TD01] [name=beta-ketothiolase BktB] [gene=bktB]
ATGCAACTGGATAGCGTTGTTATTGTAAGCGGTGCTCGCACCGCCATTGGTGGGTTTGGTGGGTCGCTCTCATCTTTCGCGCCCCATGAGTTAGGCACTATCACTGCCCAGGAAGCATTGCGCCGTGCGGGCATTGCTGGCGCTGATATCGACCACTCTGTGTATGGCCATATTATTACCACTAGCCCAGAAGATGCCTATCTTGCCCGTCATATCGCGTTGAGTGCGGGAGTGCCGAAAGAAGCGGGTGCCTTTAATGTTAACCGGTTATGTGGTTCTGGCGTGCAGGCGGTTATATCGGCGGCGCAGCAAATCGCTCTGGGCGACAGCCGCTTAGCACTAGCGGGTGGGGCTGAGTCGATGTCGCGAGGTGCTTATCTACTGCCGCCCCAAGCACGCAATGGGATACGCCTAGGCGATGCCAATATCCAGGATCTTACCCTTGGCATTCTTAGTGATCCATTTGGCAGCGGGCATATGGGGATGACCGCTGAAAATATCGCCAAGCAGTATGGCTTAAGCCGCGAGCAGCTAGATCAGTTTGCGGTGGATAGCCATCGTAAGGCGGCAAAAGCGATTGCAGAAGGGCGTTTTGACGAGCAAATCGTGCCTGTTGAAGTGACAAAAGGAAAACAGACGGTTTCCTTTGCCCGTGATGAGCATGTGCGTGAAGGCGTTGAGTTAAGTGATTTAGCACGGCTTAAGCCGGCCTTTAAAAAAGAAGGAATAGTAACGGCAGGAAACGCCTCTGGGATCAACGATGGCGCAGCGACCTTGGTGCTGGCGCATGCCGATGAAGCACAGCAGCGCAATTTAACGGTTAGGGCGCGACTTCGCGTGGCAGCCACCGCCGGTGTGGAGCCTTCGGTAATGGGGTTAGGACCAATCCCCGCGGTGAAACGCTGCCTCCAACAGGCAGGGCTGACGATCAATGATATTGATGTGATTGAGTCCAATGAAGCGTTCGCGGCACAAGCGATGGCCGTTGCCGATACGCTGGGCTTCCCATTGGAAAAACTGAACCCGAATGGTGGCGCCGTGGCGCTTGGTCATCCGGTAGGAGCGACCGGTGCCATCTTGATCCTAAAAGCCTTACACGAATTGGAGCGACGTCAGGGCCGCTATGGTTTGATCACGCTGTGTATTGGCGGTGGGCAGGGCATTGCGCTGTTAATAGAACGCGAATAA

>NZ_RRZC01000005.1:c191798-191052 phbB [protein_accession=WP_192527228.1] [organism=Halomonas citrativorans] [name=acetoacetyl-CoA reductase] [gene=phbB]
ATGGCCAATCAAGCCCCCGTCGCCTGGGTAACTGGTGGAACTGGTGGAATCGGCACGGCAATTTGTCGTTCGTTGGCAGATGCGGGTTATAGGGTAGTGGCAGGGTATAACAATCCCGAAAAAGCCAAAACCTGGCTGGACACCCAGCAAGCTGCCGGTTATCAGAAGATTACAACACTCGGGGTCGACCTGTCTGACCATAACGCATGCCTGGATGCTGCGCGTGAGATCCACGAACAGTACGGTCCAATTAGCGTGCTGGTAAACTGTGCTGGCATTACCCGCGACGGCACGATGAAAAAAATGGCCTACGAACAGTGGTATCAGGTCATCGATACCAACCTTAATAGCGTCTTTAATACTTGCCGTAGCGTGATCGAGATGATGCTCGAAAATGGCTATGGTCGAATTATTAATATCTCCTCCATCAATGGCCGTAAAGGGCAGTTTGGCCAGGTTAACTACGCTGCCGCTAAAGCCGGTATGCACGGCTTAACCATGTCGCTGGCGCAGGAAACGGCCACCAAAGGCATTACGGTAAATACCGTATCGCCTGGCTATATTGCCACCGACATGATTATGAAAATTCCGGAGTCAGTGCGTGAAGCCATTCGCGAAACGATTCCGGTAAAACGCTACGGTACGCCGGAAGAAATTGGTCGATTGGTGACGTTCCTTGCCGATAAAGAGTCTGGTTTTATTACCGGCGCCAACATCGATATTAACGGTGGGCAATTTATGGGCTAG

>NZ_CP045399.1:c2855814-2853985 phaC [protein_accession=WP_152479541.1] [organism=Halomonas sp. THAF12] [name=class I poly(R)-hydroxyalkanoic acid synthase] [gene=phaC]
ATGCAGCCAGGGAGTGAAGCATTCTCGCAGGCCGAACTGGAGGCCTGGAGCGCCCAGATCCAGGCGATCGGCGAGGAGTACAAGGCCCTCCTGGAGGACCTGATTCCGCGGATGGTGCCGGATGACGCGGCCCAGTCCGTCCATGCCCACATGCGCGAGGCCTTCCAGGCCGGGGCGGAATCGCTGATGCAGGATCCGACCCTGCTGTGGGAGACCCAGGCGCGCCTGGTGCAGGACCAGTTCCAGCTGTGGCAGAACGGCATGCGCGCCCTGGCCGGCGAGGCCGTGGAGCCGCTGATCACGCCGGCCAGGGGGGATCGCCGCTTCCAGGACGAGGCCTGGACCAGCGACCCGCACTATCTCGCCATCATGCAGCAGTACCTGCTGTTCTCGCGCTGGGTCGAGGAGCTGATCGAGCGCCTCGACGGGCTGTCCGCCGAGCAGAAACGCAACCTGGCCTTCTACGCGCGCCAGCTGGTCAACGCCATGGCGCCGACCAACTTCGTCTCCACCAATCCCGAGGTCATGCGCCGCACCATCGAGACCCGCGGCGAGAATCTGGTCGAGGGGCTGGCCCGGCTGCGCCAGGACCTGCTGGCCTCCGCCGAGGGGCTGAATGTCACCATGACCGACCGCAGCGCCTTCACCGTGGGCGAGAACATCGCCGTCACGCCGGGCTCGGTGGTGTACGAGAACGAGCTGATCCAGCTGATCCAGTACGCGCCGACCACCGAGCAGACGTTCAAGACGCCGCTGTTGATCGTGCCGCCTTGGATCAACAAGTACTACATCCTCGACCTTCGCCAGGACAACTCCCTGGTCAAGTGGCTGGTGGACCAGGGCCACACCGTGTTCCTGATCTCGTGGCGCAATCCCGGCCCCGAACAGGGTGACTTGACCTGGGCCGACTACATGCAGCTGGGCCCGATCAGCGCCATGGAGGCGATCGAGCAGGCTACCGGCGAGAAGTCGGTCAACCTGCTGAGCTATTGCGTCGGCGGCACCCTGGCCGGCTCCACGGTGGCCTACCTGACCAGCACCCGGCGCGGGCGCAAGGTCAAGTCGGCGACCTACATGACCAGCCTGTGGGACTTCCGCGATCCCGGCGAGATCGGTGTCTTCCTCGGCGAGCCGGTGCTCAGCGGCATCGAGGCCAAGCTCGAGCAGGACGGCTACCTGGACGGGCGCATCATGGCCTACTCCTTCAACCTGCTGCGCGAGAACGACCTGTTCTGGTCCTTCTACATCAACAACTACCTCAAGGGCGACATTCCGGCGCCCTTCGACCTGCTGTACTGGAACACCGACGGCACCAACCTGCCGGCGGCCACCCATGGCTGGTATCTGCGCCATCTCTATGCCGAGAACCGCCTGGTCGAGCCCGGCGGCATCGAGCTCGATGGCGTGAAGATCGACCTGCGCAAGATCTCGGTGCCGAGCTACTTCGTCTCCACCCGCGACGATCACATCGCCAAGTGGAACAGCACCTACTACGGGGCCCTGCTGCCCAAGGGGCCGGTGAAGTTCGTGCTGGGCGGGTCCGGCCATATCGCCGGTATCGTCAATCCGCCGCACAAGAACAAGTACGGCTTCTGGACCAACGACGCGCTGCCGCCGACCCCGGAGGAGTGGCTGGAAGGGGCCGAGGCCCACGAAGGCTCGTGGTGGCCGAACTGGCAGGCCTGGATGACCGACAACGGCTACGCCGACGCCGAGAAGATGGTGCCGGCGCGCCAGCCGGGCGACGGCGAGCTGGATATCCTCGAGCCGGCGCCCGGGCGCTTCGTGCGCATGACCATCCCCGAGGTGCTGGGCGAGCCCCAGGCCTGA

What host or chassis? The living system from HW1, for example E. coli, S. cerevisiae, CHO or another mammalian line, or a cell-free system. Your host drives almost every part choice that follows.

The primary production chassis is Halomonas TD02, a derivative of wild-type Halomonas TD01 with deletions in the restriction-modification system genes hsdRMS, re1, and re2. These deletions were introduced to reduce restriction of incoming foreign DNA and improve genetic accessibility. The strain is intended to serve as the host for the PHB-production pathway. Escherichia coli S17-1 λpir will serve as the conjugation donor, carrying the vector for transfer into the Halomonas recipient.

Where does the product need to go? Cytoplasm, secreted, membrane, or a compartment? This decides whether you need a signal peptide or targeting sequence.

The PhaA, PhaB, and PhaC enzymes will function in the cytoplasm of Halomonas TD02. PHB is synthesized intracellularly and accumulates as polymer granules within the bacterial cells. Therefore, the construct does not require a secretion signal peptide or a membrane-targeting sequence.

Part 2: Design your genetic parts

Part 3: Assemble your construct

The TD01 porin promoter drives transcription, BBa_B0034 RBS elements support translation initiation for PhaA, PhaB, and PhaC, and the native TD01 A02 terminator limits transcriptional read-through. The pSEVA341 vector provides the genetic backbone, including a chloramphenicol-resistance marker and transfer element for conjugative delivery using _E. col_i S17-1 λpir as the donor.

Part 4: Optimize and quality-check

Codon-optimize your CDS for your chosen host. Compare before and after: what changed, and why does codon usage matter for expression in this organism? Note any constraints you applied (e.g. avoiding certain restriction sites, GC content).

The optimized sequence produced by the software may be considered suitable for expression in E. coli because it was generated according to the specified optimization parameters, including the selected E. coli host strategy and avoidance of CpG motifs. Compared with the original Halomonas coding sequence, the optimized version is intended to improve compatibility with the target host while maintaining the required coding information.

Search your sequence (BLAST / sequence search) against known sequences. Is your CDS what you think it is? Is it identical to a natural gene, or novel? What is the closest match?

The BLAST result for phaA shows that the selected coding sequence matches a naturally occurring gene from Halomonas listed in the database. The result shows 100% query coverage, 100% sequence identity, and an E-value of 0, indicating that the entire query sequence aligns with the reference sequence and that the aligned nucleotides are identical. These results support the identification of the selected sequence as the native phaA gene. The BLAST result for phaB and phaC showed the same outcome.

Run the safety screen on your construct. Summarize what it checks for and what it reports. If it flags something, explain whether it is expected for your design and how you would respond.

The biosecurity screening result indicated that no flagged sequences were detected. This means that the software did not identify any sequence features that met its predefined criteria for biosecurity concern during the screening process.

Part 5: From design to build

How would you build it? Would you order it as synthetic DNA, assemble it from smaller fragments (e.g. Gibson assembly), or build it from a pool of oligos synthesized on a chip? Justify your choice given your construct’s length and complexity. What does synthesis constrain? Synthesis has error rates and struggles with certain sequences. Does your design contain anything hard to synthesize? How would error correction or fragment-based assembly change your approach? Prototype vs. scale. Mirroring HW1: the way you’d build one construct to test your idea may differ from how you’d produce DNA at the scale your product needs. Briefly describe both if they differ.

For the initial construct, I would first consider ordering the sequence as synthetic DNA because it provides a relatively straightforward way to obtain the designed construct for testing. However, I have not yet fully evaluated the sequence for synthesis constraints, so this choice is still preliminary. If the analysis shows that the construct is difficult (synthesis errors, repetitive regions) or expensive to synthesize as one piece, I would consider dividing it into smaller fragments and assembling them using Gibson assembly. If Gibson assembly is more cost-effective and the assembly can be performed reliably, it could also be a practical option even if it requires more steps. Therefore, the final construction strategy would depend on the construct length, sequence complexity, synthesis feasibility, cost, and the number of assembly steps required.

For the prototype stage, obtaining a single commercially synthesized construct would be the simplest approach for testing the design. If the design were eventually required at larger scale, the production strategy could be changed to a more standardized and cost-efficient DNA manufacturing process. Thus, the method used to validate one construct does not necessarily have to be the same method used for larger-scale production.

Part 6: What don’t you know yet?

The expression levels of the three genes arranged in a polycistronic conformation are still unknown, and one gene may be expressed at a different level from the others. Additionally, combining the promoter, multiple RBSs, three coding sequences, terminator, and vector creates a relatively large construct. The native sequences may contain features that make DNA synthesis or assembly more difficult, even though they are biologically appropriate for TD02. Another uncertainty is whether the sequence would be easy and cost-effective to synthesize. The synthesis constraints have not been fully evaluated yet, so it is not clear whether direct synthesis would be practical. A synthesis-feasibility check would help identify any difficult regions or potential synthesis problems. If direct synthesis were not practical, the sequence could instead be divided into smaller fragments and assembled using a method such as Gibson assembly.

AI Use Disclosure

ChatGPT (OpenAI was used to help me understand different parts and kinds of the genetic construct. I also used it to clarify concepts such as polycistronic gene expression, codon optimization, and DNA synthesis scalability.

References

Li, T., Li, T., Ji, W., Wang, Q., Zhang, H., Chen, G., Lou, C., & Ouyang, Q. (2015). Engineering of core promoter regions enables the construction of constitutive and inducible promoters in Halomonas sp. Biotechnology Journal, 11(2), 219–227. https://doi.org/10.1002/biot.201400828

Tan, D., Wu, Q., Chen, J., & Chen, G. (2014). Engineering Halomonas TD01 for the low-cost production of polyhydroxyalkanoates. Metabolic Engineering, 26, 34–47. https://doi.org/10.1016/j.ymben.2014.09.001

Ye, J., & Chen, G. (2021). Halomonasas a chassis. Essays in Biochemistry, 65(2), 393–403. https://doi.org/10.1042/ebc20200159

Xu, M., Chang, Y., Zhang, Y., Wang, W., Hong, J., Zhao, J., Lu, X., & Tan, D. (2022). Development and Application of Transcription Terminators for Polyhydroxylkanoates Production in Halophilic Halomonas bluephagenesis TD01. Frontiers in Microbiology, 13, 941306. https://doi.org/10.3389/fmicb.2022.941306

https://seva-plasmids.com/find-your-plasmid/

Final Project